Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_001654 | |||
Gene | n/a | Organism | Human |
Genome Locus | chr6:42903447-42905047:+ | Build | hg19 |
Disease | Infantile Hemangioma (IH) | ICD-10 | Haemangioma, any site (D18.0) |
DBLink | Link to database | PMID | 29095957 |
Experimental Method | |||
Sample Type | Tissues | Comparison | Infantile Hemangioma (IH) and adjacent normal tissues |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward ATATGTGCAGGGGTTGTGG ReverseTCACACCAGCAGACACACTAAG | Statistics | Fold Change : Downregulated pvalue : p=0.005 |
Citation | |||
Fu, C, Lv, R, Xu, G, Zhang, L, Bi, J, Lin, L, Liu, X, Huo, R (2017). Circular RNA profile of infantile hemangioma by microarray analysis. PLoS ONE, 12, 11:e0187581. |